Web寻找 Abcam 抗体及试剂 - Abcam中文官网 WebThis product is manufactured by BioVision, an Abcam company and was previously called 3491R Fis1 Polyclonal Antibody. The Life Science industry has been in the grips of a …
Did you know?
WebMar 6, 2024 · Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) analysis of human kidney tissue sections labeling TTC11/FIS1 with Purified ab156865 at … WebFIS1 (a.k.a. CGI-135, TTC11) Cloning Information Cloning method Gibson Cloning 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG 3′ sequencing primer ATAGCGTAAAAGGAGCAACA (Common Sequencing Primers) Terms and Licenses. Academic/Nonprofit Terms. UBMTA; Institut Pasteur Label License for ...
WebBoster Bio Anti-TTC11/FIS1 Antibody catalog # A01932-2. Tested in ELISA, Flow Cytometry, IF, IHC, ICC, WB applications. This antibody reacts with Human, Mouse, Rat. Supplied as … WebAnti-TTC11/FIS1 antibody (ab286127) Datasheet. SDS. Submit a review Submit a question. $670 Product size. 100 µg. Add to basket. The lead time on this item is currently 1-2 …
Web(ab156865) Anti-TTC11/FIS1 antibody [EPR8412] - Abcam - CiteAb. 16 citations – A rabbit monoclonal antibody, raised against Mitochondrial fission 1 protein (Human), supplied by Abcam. ... FIS1 homolog, Tetratricopeptide repeat protein 11, FIS1_HUMAN. UniProt Code History Q9BTP3, Q9Y3D6. Gene Synonyms FIS1, TTC11, CGI-135. WebAnti-FIS1 antibodies are offered by a number of suppliers. This target gene encodes the protein 'fission, mitochondrial 1' in humans and may also be known as CGI-135, TTC11, mitochondrial fission 1 protein, and FIS1 homolog. Structurally, the protein is reported to be 16.9 kilodaltons in mass.
WebAnti-TTC11/FIS1 antibody [EPR8412] (ab156865) Research with confidence – consistent and reproducible results with every batch. Long-term and scalable supply – powered by …
WebMitochondrial fission 1 protein, FIS1, Tetratricopeptide repeat protein 11, TPR repeat protein 11, TTC11, FIS1 Homolog, Fission, Mitochondrial 1, hFIS1 Isotype Rabbit Polyclonal IgG Ave. Rating Submit a Review Product Citations publications. Western blot of ... crysis 3 remastered cheat tableWebRecommended software programs are sorted by OS platform (Windows, macOS, Linux, iOS, Android etc.) and possible program actions that can be done with the file: like open tt11 … dutch professionals networkWebThis highly specific TTC11 / FIS1 antibody is suitable for use in WB, IHC-P, IF, Direct ELISA and is guaranteed to work as stated on the product data sheet. RQ6990 Tel: … dutch property finance 2022WebCGI135; FIS1; hFis1; TTC 11; Immunogen. A synthesized peptide derived from human TTC11. Storage. Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Store at +4°C short term. Store at -20°C long term. Avoid freeze / thaw cycle. Purification. dutch products usaWebRabbit Monoclonal FIS1 antibody [GT1188]. Validated in WB, ICC/IF, IHC-P, IP. Tested in Human, Mouse, Rat. United States (US) Country ... TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008] dutch processed cocoa powder hersheyWebAll lanes : Anti-TTC11/FIS1 antibody - N-terminal (ab189846) at 1/500 dilution Lane 1 : 293T cell line extract Lane 2 : HepG2 cell line extract Lane 3 : A549 cell line extract Lane 4 : … dutch products perthWebFeb 24, 2024 · Fis1 Antibody (B-5) is an IgG 2a κ mouse monoclonal Fis1 antibody (also designated FIS-1 antibody, fission, mitochondrial 1 antibody, tetratricopeptide repeat domain 11 antibody, TTC11 antibody, or CGI-135 ORF antibody) suitable for the detection of the Fis1 protein of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA. Fis1 … dutch property finance 2022-1